Urea and thiohydantoin are among the important privileged structures for drug discovery. We have developed a synthetic approach to the high-throughput synthesis of the heterobivalent compounds containing both urea and 5-arylidene-2-thiohydantoin functional groups. This synthetic methodology was applied to the synthesis of a mixture-based library containing a total of 5280 compounds in a positional scanning format. The library was screened for its antiproliferative activity against cancer cells using a tetrazolium dye (MTT) based assay. Deconvolution of the library identified six hit compounds exhibiting moderate inhibitory potency against cancer cell proliferation.

Tricyclic pyrone (TP) molecules have shown protection of MC65 neuroblastoma cells death induced by amyloid-β proteins through SβC gene, a decrease of amyloid-β peptide levels, and improvement of motor functions and memory in Alzheimer's disease mouse and rat models. Mechanistic studies suggest TP molecules modulate -methyl--aspartate receptor. A short synthesis of chiral TP analogs was sought using a Pd(0)-catalyzed displacement of TP allylic acetate intermediate with sodium azide or substituted benzylamines. A three-step sequence of reactions by the treatment of 2-{(5aS,7S)-3-methyl-1-oxo-1,5a,6,7,8,9-hexahydropyrano[4,3-b]chromen-7-yl}allyl acetate () with (PhP)Pd and sodium azide, followed by reduction with Zn-NHOCHO and coupling with 3-fluoro-4-hydroxybenzaldehyde and NaCNBH was found to give TP coupling molecule, (5a,7)-7-(1-(3-fluoro-4-hydroxybenzylamino)prop-2-en-2-yl)-3-methyl-6,7,8,9-tetrahydropyrano[4,3-b]chromen-1(5a)-one (), in a good yield. An alternative shorter pathway - a two-step sequence of reactions - by the displacement of by 4-(-butyldimethylsilyloxy)-3-fluoro-benzylamine with a catalytic amount of (PhP)Pd in THF followed by removal of the silyl ether protecting group gave , albeit in a lower chemical yield. The described syntheses should provide general procedures for the synthesis of a library of TP molecules for the discovery of anti-Alzheimer drugs.

A heteroaryl sulfonyl(VI) fluoride, 4-chloro-7-fluorosulfonyl-2,1,3-benzoxadiazole, was synthesized from its chloride counterpart (4-chloro-7-chlorosulfonyl-2,1,3-benzoxadiazole) and the X-ray structure analysis of these compounds and the interactions in the solid-state were thoroughly examined. Hirshfeld surface analysis is used to provide a thorough and complete picture of the changes arising from the different halides in the functional groups. Surface analysis reveals that the fluoride does not participate in any hydrogen interactions as opposed to the chloride. However, the fluorine atom is observed to form close interactions with several π bonds. For both moieties, however, the sulfonyl oxygens show comparable interactions with respect to both magnitude and interatomic distances. The Hirshfeld surface analysis is coupled with computational studies to help elucidate the observed interactions that are found from the distinct nitrogen, chlorine, and oxygen atoms present in the molecules, providing new physical insights to the correlation between their structures and properties.

Alcohol-based hand sanitizers (ABHSs) containing ethanol (EtOH) or isopropyl alcohol (IPA) to inactivate microorganisms help prevent the spread of respiratory diseases. These products have become very popular during the COVID-19 pandemic. Apart from vaccines or other preventative antiseptic measures, the majority of consumers have relied on different types of ABHSs to disinfect their hands. As a result, there has been a global rush in the demand for these ABHSs and other antiseptic hygiene products. This has resulted in the formation of many new commercial sanitizer producers. There are around fifty companies of varying sizes that have been marketing their ABHSs in Bangladesh, most of which have only been manufacturing their products for the first time since the COVID-19 pandemic. To monitor the quality and components of these products, the Bangladesh Council of Scientific and Industrial Research (BCSIR) analyzed approximately 200 different hand sanitizer samples using GC-FID method. All samples were alcohol-based except for 3 which were alcohol-free aqueous hand sanitizers. Of the supplied formulated ABHSs, 80 samples were found to contain only IPA and 54 contained only EtOH. However, 28 samples were found to be contaminated with methanol (MeOH), 7 samples contained only MeOH and 18 samples contained both EtOH and IPA. This is the first study to explore the analysis of alcohol content in formulated ABHSs and their marketing status in Bangladesh, but the findings could be of use in other jurisdictions as similar issues have been raised in many parts of the world.

Despite the significant development in vaccines and therapeutics cocktails, there is no specific treatment available for coronavirus disease 2019 (COVID-19), caused by the new severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Targeting the main protease (M) of SARS-CoV-2, which possesses a key role in producing the essential viral structural and functional proteins, can be considered an efficient way to control this potentially lethal infection. Recently, some of Michael acceptor-pharmacophore containing inhibitors have been suggested as successful suppressors of the main protease. Here, we synthesized the Isatin-based Schiff bases possessing the structural pattern of a Michael acceptor-like portion employing synthesis procedures. investigation of these compounds was not limited to the main protease. We have also evaluated their possible inhibitory activity against the other identified druggable targets using homology modeling, molecular docking, and molecular dynamics simulations. Our investigations revealed that the dimethyl biguanide carrying Schiff bases of Isatin-derivatives have the best binding mode and interaction energy. The dimethyl biguanide moiety-containing compounds have formed promising interactions with the key amino acid residues Cys145 and HIS41 of M with a binding free energy of -7.6 kcal/mol which was lower than the positive control compound Carmofur (-6.3 kcal/mol). It also leads to the higher affinity and the much inhibitory potential against the SARS-CoV-2 RdRp and Spike glycoproteins, human TMPRSS2, and ACE2 receptors.

Given the rapid progression of the coronavirus disease 2019 (COVID-19) pandemic, an ultrafast response was urgently required to handle this major public crisis. To contain the pandemic, investments are required to develop diagnostic tests, prophylactic vaccines, and novel therapies. Lately, nucleoside analog (NA) antivirals topped the scene as top options for the treatment of COVID-19 caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections. Meanwhile, the continuous generation of new lineages of the SARS-CoV-2 Omicron variant caused a new challenge in the persistent COVID-19 battle. Hitting the two crucial SARS-CoV-2 enzymes RNA-dependent RNA polymerase (RdRp) and 3'-to-5' exoribonuclease (ExoN) collectively together using only one single ligand is a very successful new approach to stop SARS-CoV-2 multiplication and combat COVID-19 irrespective of the SARS-CoV-2 variant type because RdRps and ExoNs are broadly conserved among all SARS-CoV-2 strains. Herein, the current comprehensive study investigated most NAs libraries, searching for the most ideal drug candidates expectedly able to perfectly act through this double tactic. Gradual computational filtration gave rise to six different promising NAs, which are riboprine, forodesine, tecadenoson, nelarabine, vidarabine, and maribavir, respectively. Further biological assessment proved for the first time, using the anti-RdRp/ExoN and anti-SARS-CoV-2 bioassays, that riboprine and forodesine, among all the six tested NAs, are able to powerfully inhibit the replication of the new virulent strains of SARS-CoV-2 with extremely minute anti-RdRp and anti-SARS-CoV-2 EC values of about 0.22 and 0.49 μM for riboprine and about 0.25 and 0.73 μM for forodesine, respectively, surpassing both remdesivir and the new anti-COVID-19 drug molnupiravir. The prior data supported these biochemical findings, suggesting that riboprine and forodesine molecules strongly hit the key catalytic pockets of the SARS-CoV-2 (Omicron variant) RdRp's and ExoN's main active sites. Additionally, the ideal pharmacophoric features of riboprine and forodesine molecules render them typical dual-action inhibitors of SARS-CoV-2 replication and proofreading, with their relatively flexible structures open for diverse types of chemical derivatization. In Brief, the current important results of this comprehensive study revealed the interesting repurposing potentials of, mainly, the two nucleosides riboprine and forodesine to effectively shut down the polymerase/exoribonuclease-RNA nucleotides interactions of the SARS-CoV-2 Omicron variant and consequently treat COVID-19 infections, motivating us to rapidly begin the two drugs' broad preclinical/clinical anti-COVID-19 bioevaluations, hoping to combine both drugs soon in the COVID-19 treatment protocols.

The extraordinary occurrence of COVID-19 by the fast expansion of viral infections has propelled particular interest in developing novel antiviral and virucidal agents to guarantee personal security. The main objective of this work is to propose novel formulations able to optimize the use of personal protection elements. In recent years, chitosan (CH) has attracted attention for being an interesting multifunctional, biodegradable, non-antigenic, non-toxic, and biocompatible natural polymer with antimicrobial properties. In this work, formulations based on a CH matrix containing silver, and Copper based nanoparticles have been developed. The novelty of this proposal is that almost liquid formulations have been reached, possessing verified properties to inhibit evolved virus such as 1 (HSV-1) and (BCoV), the latter belonging to the same family of the well-known the well-known SARS-CoV-2. Besides antibacterial bioactivity; as well as the ability of these formulations to be easily sprayed on various surfaces, including conventional face masks, have been verified and discussed. The results presented in this contribution provide strong evidence on CH films as an ideal biosafe surface-protective for several daily used materials including the conventional face masks.

Due to the 2019 SARS-CoV-2 outbreak, low-cost, fast, and user-friendly diagnostic kits for biosensing SARS-CoV-2 in real samples employing multiple working electrodes are in high demand. Choosing SARS-CoV-2 detecting electrodes is difficult because each has advantages and limitations. Carbon-based electrochemical sensing applications have attracted attention from the electrochemical sensing community because carbon and carbon-based materials have been a godsend for testing utilizing an electrochemical platform. Carbon working electrode electrochemical platforms are cost-effective and fast. Covid-sensors use carbon-based materials because they can be easily changed (with inorganic and organic functionalities), have quick response kinetics, and are chemically resistant. Covid-19 sensing materials include graphene and graphite. This review explains how carbon materials have been employed in N and S protein electrochemical detection. Here, we discussed a carbon-based technology for SARS-CoV-2 biosensing. We've compared carbon-based electrochemical sensing to different electrodes.

studies in terms of density functional theory (DFT), molecular docking, and ADMET (absorption, distribution, metabolism, excretion and toxicity) were performed for 55 thiazolidinones compounds derived from different amines and aldehydes. DFT is a computational quantum mechanical modeling method used to predict the various properties of the compounds. Different parameters such as Electronegativity (x), Chemical Hardness (ŋ), Chemical Potential (μ), Ionization potential (IP), and Electron Affinity (EA), etc. were calculated by Koopmans theorem. The compounds were docked with Molecular Operating Environment (MOE) software using already reported PDB files of BChE, AChE, and α-glucosidase. To analyze the Spike Glycoprotein of SARS-Cov-2 and heterocyclic compounds, molecular interactions study was carried out between Spike Glycoprotein of SARS-Cov-2 (6VXX) and 55 synthetic heterocyclic compounds. It was performed by the utilization of PyRx Virtual Screening Tool and AutoDock Vina based virtual environment was used in PyRx. Maximum binding affinity was observed with compound which was -8.7 kcal/mol and then with which was -8.5 respectively. In the case of the AChE enzyme, has a maximum docking score of -12.9027 kcal/mol while depicted the maximum score for the BChE enzyme with a value of -8.6971 kcal/mol. The docking studies revealed that compound has maximum binding capacity toward glucosidase (-14.8735 kcal/mol). ADMET properties of under consideration compounds were determined by Swiss online-based software which concluded that these molecules have a drug-like properties and having no violation.

Three new compounds of amidophosphoric acid esters with a [OCHC(CH)CHO]P(O)[] segment (where =cyclopentylamido (), 2-aminopyridinyl () and pyrrolidinyl ()) were synthesized and studied using FT-IR and P/C/H NMR spectroscopies and single-crystal X-ray diffraction analysis. The compounds crystallize in the triclinic space groups for and and in the orthorhombic space group 2 for , where the asymmetric unit consists of three symmetrically-independent molecules for and one molecule for and . The intermolecular interactions and supramolecular assemblies are assessed by Hirshfeld surface analysis and enrichment ratios. The results reveal that the substituent effect plays an important role in directing the supramolecular structures. The presence of the aromatic substituent aminopyridine in providing the C-H…π interactions leads to a larger variety in interactions including H…H, H…O/O…H, H…C/C…H and H…N/N…H contacts, whereas the packings of the compounds and bearing aliphatic substituents only include H…H and H…O/O…H contacts. The enrichment ratios affirm the importance of O…H/H…O contacts reflecting the hydrogen bond N-H…O interactions to be the enriched contacts. Compounds were also investigated along with five similar reported structures with a [OCHC(CH)CHO]P(O) segment for their inhibitory behavior against SARS-CoV-2. The molecular docking results illustrate that the presence of the aromatic amido substituent the aliphatic type provides a more favorable condition for their biological activities.

The unprecedented novel coronavirus disease 2019 (COVID-19) pandemic is a threat to global health and the economy. Since the outbreak of COVID-19, great effort has been made to reposition existing drugs to shorten development timelines, in addition to vaccine development and drug discovery campaigns. Umifenovir is a broad-spectrum antiviral agent used to treat influenza in China and Russia and is currently undergoing clinical trials for the treatment of COVID-19. In this article, the synthesis of umifenovir analogues and their biological evaluation are reported. The inhibitory activities of analogues against the binding of the spike glycoprotein (S-protein) of the novel severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) to the ACE2 receptor, which is a possible mode of action for umifenovir to inhibit viral infection, were investigated.

Due to alarming outbreak of pandemic COVID-19 in recent times, there is a strong need to discover and identify new antiviral agents acting against SARS CoV-2. Among natural products, lignan derivatives have been found effective against several viral strains including SARS CoV-2. Total of twenty-seven reported antiviral lignan derivatives of plant origin have been selected for computational studies to identify the potent inhibitors of SARS CoV-2. Molecular docking study has been carried out in order to predict and describe molecular interaction between active site of enzyme and lignan derivatives. Out of identified hits, clemastatin B and -strebluslignanol G demonstrated stronger binding and high affinity with all selected proteins. Molecular dynamics simulation studies of clemastin B and savinin against promising targets of SARS CoV-2 have revealed their inhibitory potential against SARS CoV-2. In fine, computational studies have provided initial breakthrough in design and discovery of potential SARS CoV-2 inhibitors.

Herein, we report two novel multidentate luminogen proligands bis(3,5-diiodosalicylidene) carbohydrazone (HL) and bis(3,5-diiodosalicylidene) thiocarbohydrazone (HL), which are suitable candidates for biomedical applications. Though the thiocarbohydrazone HL shows aggregation caused quenching (ACQ), the carbohydrazone HL exhibits stronger fluorescence due to aggregation induced emission enhancement (AIEE). Molecular docking studies of HL and HL along with four similar (thio)carbohydrazones with the active sites of SARS-CoV-2 main protease 3CL reveals that the thiocarbohydrazones, in general, are showing better propensity compared to their oxygen analogues. Both the thiocarbohydrazones and the carbohydrazones, however, exhibit better binding potential at the active sites than that of some of the repurposed drugs such as chloroquine, hydroxychloroquine, lopinavir, ritonavir, darunavir and remdesivir. Also, the carbohydrazone HL can be a better bioprobe compared to HL as the former is found to have better binding potential with SARS-CoV-2 spike glycoprotein along with AIEE feature.

Natural compounds in medicinal plants are best remedies for different diseases and are important to develop new drugs. This work was dedicated to understand the role of different natural compounds of , a well-known herbal plant, in the treating of Covid 19. In this article, we have investigated interactions of such natural compounds from with the main protease (M) of the SARS-CoV-2, which is a key component for cleavage of viral polyprotein, and an important target for the development of drugs towards COVID-19. We have performed molecular docking study on 22 different molecules of and proposed that 7 of the natural compounds (triterpenoids and sterols) interacts with a comparable or stronger interactions than the inhibitor N3. Molecular dynamics simulations (100 ns) revealed that 7 M- complexes are stable, conformationally less fluctuated, slightly less compact, and marginally expanded than ligand-free conformation of M. The intermolecular H-bonding and detailed MM/PBSA and MM-GBSA analysis showed Daucosterol interaction to be the most strong, whereas comparable interactions were observed for Arjunetin, Maslinic acid, and Bellericoside. Our study suggested that these natural compounds can act as potent M inhibitors for SARS-CoV-2, and may evolve as promising anti-COVID-19 drugs in the near future.

A series of chloroquine analogs were designed to search for a less toxic chloroquine derivative as a potential SARS-CoV-2 Mpro inhibitor. Herein, an ANN-based QSAR model was built to predict the IC values of each analog using the experimental values of other 4-aminoquinolines as the training set. Subsequently, molecular docking was used to evaluate each analog's binding affinity to Mpro. The analog that showed the greatest affinity and lowest IC values was synthesized and characterized for its posterior incorporation into a polycaprolactone-based nanoparticulate system. After characterizing the loaded nanoparticles, an drug release assay was carried out, and the cytotoxicity of the analog and loaded nanoparticles was evaluated using murine fibroblast (L929) and human lung adenocarcinoma (A549) cell lines. Results show that the synthesized analog is much less toxic than chloroquine and that the nanoparticulate system allowed for the prolonged release of the analog without evidence of adverse effects on the cell lines used; therefore, suggesting that the analog could be a potential therapeutic option for COVID-19.

Amid the current COVID-19 pandemic, the emergence of several variants in a relatively high mutation rate (twice per month) strengthened the importance of finding out a chemical entity that can be potential for developing an effective medicine. In this study, we explored ethyl acetate (EtOAc) extract of a marine-derived fungus afforded three butenolide derivatives, butyrolactones I, VI and V (-), two naphtho--pyrones, TMC-256 A1 () and rubrofusarin B () and methyl -hydroxyphenyl acetate (). Structure identification was unambiguously determined based on exhaustive spectral analyses including 1D/2D NMR and mass spectrometry. The isolated compounds (-) were assessed for their in vitro anti-inflammatory, antiallergic, elastase inhibitory activities and in silico SARS-CoV-2 main protease (M). Results exhibited that only butenolides ( and ) revealed potent activities similar to or more than reference drugs unlike butyrolactone V () suggesting them as plausible chemical entities for developing lead molecules.

We developed an electrochemical biosensing platform using gold-clusters, cysteamine, the spike protein of the severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) antigen and bovine serum albumin on a glassy carbon electrode able to determine the SARS-CoV-2 spike antibody. The developed biosensor could detect 9.3 ag/mL of the SARS-CoV-2 spike antibody in synthetic media in 20 min in a linear range from 0.1 fg/mL to 10.0 pg/mL. The developed method demonstrated good selectivity in the presence of spike antigens from other viruses. Clinical samples consisting of gargle and mouthwash liquids were analyzed with both RT-PCR and the developed biosensor system to reveal the sensitivity and specificity of the proposed method. Moreover, the developed method was compared with the lateral flow immunoassay method in terms of sensitivity.

The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.

Natural products recognized traditionally as a vital source of active constituents in pharmacotherapy. The COVID-19 infection caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is highly transmissible, pathogenic, and considered an ongoing global health emergency. The emergence of COVID-19 globally and the lack of adequate treatment brought attention towards herbal medicines, and scientists across the globe instigated the search for novel drugs from medicinal plants and natural products to tackle this deadly virus. The natural products rich in scaffold diversity and structural complexity are an excellent source for antiviral drug discovery. Recently the investigation of several natural products and their synthetic derivatives resulted in the identification of promising anti SARS-CoV-2 agents. This review article will highlight the pharmacological relevance and chemical synthesis of the recently discovered natural product and their synthetic analogs as SARS-CoV-2 inhibitors. The summarized information will pave the path for the natural product-based drug discovery of safe and potent antiviral agents, particularly against SARS-CoV-2.

In this study, the inhibitory potency of four adamantly- isothiourea derivatives (compounds [4-bromobenzyl (Z)-N'-(adamantan-1-yl)-4-phenylpiperazine-1-carbothioimidate], [3,5-bis(trifluoromethyl)benzyl (Z)-N'-(adamantan-1-yl)-4-phenylpiperazine-1-carbothioimidate], [4-bromobenzyl (Z)-N-(adamantan-1-yl)morpholine-4-carbothioimidate] and [3,5-bis(trifluoromethyl)benzyl (Z)-N-(adamantan-1-yl)morpholine-4-carbothioimidate]) was evaluated against SARS-CoV-2 targeted proteins. The investigated compounds - possess a similar structure to opaganib, which is used in studies like a potential drug for COVID-19 treatment. Since examined adamantly-isothiourea derivatives (-) shown broad-spectrum of antibacterial activity and significant cytotoxic effects against five human tumor cell lines and shown similarity in structure with opaganib, it was of interest to study their inhibitory potency toward some SARS-CoV-2 proteins such as SARS-CoV-2 main protease M and mutation of SARS-CoV-2 Spike (S) Protein D614G. The inhibitory potency of studied compounds is examined using molecular docking and molecular dynamic simulations. The results of molecular docking simulations indicate compound as the most prominent candidate of inhibition of SARS-CoV-2 main protease M (▵G=11.24 kcal/mol), while almost the same inhibition potency of all studied compounds is exhibited toward D614G. Regarding the results obtained by molecular dynamic simulations, compounds and possess similar inhibitory potency toward SARS-CoV-2 main protease M as opaganib (▵G 40 kcal/mol).

SARS-CoV-2 virus during its spread in the last one and half year has picked up critical changes in its genetic code i.e. mutations, which have leads to deleterious epidemiological characteristics. Due to critical role of spike protein in cell entry and pathogenesis, mutations in spike regions have been reported to enhance transmissibility, disease severity, possible escape from vaccine-induced immune response and reduced diagnostic sensitivity/specificity. Considering the structure-function impact of mutations, understanding the molecular details of these key mutations of newly emerged variants/lineages is of urgent concern. In this review, we have explored the literature on key spike mutations harbored by , , and 'variants of concern' (VOCs) and discussed their molecular consequences in the context of resultant virus biology. Commonly all these VOCs i.e. and lineages have decisive mutation in Receptor Binding Motif (RBM) region and/or region around Furin cleavage site (FCS) of spike protein. In general, mutation induced disruption of -molecular interaction enhances molecular flexibility leading to exposure of spike protein surface in these lineages to make it accessible for -molecular interaction with hACE2. A disruption of spike antigen-antibody -molecular interactions in epitope region due to the chemical nature of substituting amino acid hampers the neutralization efficacy. Simplified surveillance of mutation induced changes and their consequences at molecular level can contribute in rationalizing mutation's impact on virus biology. It is believed that molecular level dissection of these key spike mutation will assist the future investigations for a more resilient outcome against severity of COVID-19.