Clustered, regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein (Cas) system is a new gene editing tool that represents a revolution in gene therapy. This study aimed to review the clinical trials conducted to evaluate the efficacy and safety of the CRISPR/Cas9 system in treating thalassemia and sickle cell disease (SCD). We searched relevant literature using "CRISPR Cas", "thalassemia", "sickle cell" and "clinical trial" as subject terms in PubMed, Cochrane, Web of Science, and Google Scholar up to December 3rd, 2023. Following the PIO format (Patients, Intervention, Outcome), PRISMA guidelines were followed in the study selection, data extraction, and quality assessment processes. Out of 110 publications, 6 studies met our eligibility criteria with a total of 115 patients involved. CRISPR/Cas9 system was used to disrupt BCL11A gene enhancer in 4 studies and to disrupt γ-globin gene promoters in 2 studies. Patients demonstrated significant activation of fetal hemoglobin, elevated total hemoglobin, transfusion independence in thalassemia, and repression of vaso-occlusive episodes in SCD. Using CRISPR/Cas9 system to directly disrupt genes provides a safe and potential one-time functional cure for thalassemia and SCD, suggesting CRISPR/Cas9 as a potential therapeutic tool for the treatment of inherited hematological disorders.

The etiological agent for the coronavirus disease 2019 (COVID-19), the SARS-CoV-2, caused a global pandemic. Although mRNA, viral-vectored, DNA, and recombinant protein vaccine candidates were effective against the SARS-CoV-2 Wuhan strain, the emergence of SARS-CoV-2 variants of concern (VOCs) reduced the protective efficacies of these vaccines. This necessitates the need for effective and accelerated vaccine development against mutated VOCs. The development of multi-epitope vaccines against SARS-CoV-2 based on in silico identification of highly conserved and immunogenic epitopes is a promising strategy for future SARS-CoV-2 vaccine development. Considering the evolving landscape of the COVID-19 pandemic, we have conducted a bibliometric analysis to consolidate current findings and research trends in multi-epitope vaccine development to provide insights for future vaccine development strategies. Analysis of 102 publications on multi-epitope vaccine development against SARS-CoV-2 revealed significant growth and global collaboration, with India leading in the number of publications, along with an identification of the most prolific authors. Key journals included the Journal of Biomolecular Structure and Dynamics, while top collaborations involved Pakistan-China and India-USA. Keyword analysis showed a prominent focus on immunoinformatics, epitope prediction, and spike glycoprotein. Advances in immunoinformatics, including AI-driven epitope prediction, offer promising avenues for the development of safe and effective multi-epitope vaccines. Immunogenicity may be further improved through nanoparticle-based systems or the use of adjuvants along with real-time genomic surveillance to tailor vaccines against emerging variants.

Glucanases are widely applied in industrial applications such as brewing, biomass conversion, food, and animal feed. Glucanases catalyze the hydrolysis of glucan to produce the sugar hemiacetal through hydrolytic cleavage of glycosidic bonds. Current study aimed to investigate structural insights of a glucanase from Clostridium perfringens through blind molecular docking, site-specific molecular docking, molecular dynamics (MD) simulation, and binding energy calculation. Furthermore, we aimed to enhance structural stabilization through formation of hydrophobic interaction network. The molecular docking results illustrated that residues Glu222 and Asp187 may act as nucleophile acid/base catalyst. Moreover, the MM/PBSA results illustrated a high binding affinity of 108.71 ± 8.5 kJ/mol between glucanase and barely glucan during 100 ns simulation. The RMSF analysis illustrated a high flexible surface loop with the highest mobility at position D130. Therefore, the structural engineering was carried out through introducing a double-mutant S125Y/D130P, and the structural stability was improved by forming the hydrophobic interaction network and one π-π aromatic interaction. The spatial distance between the mutation sites and the catalytic pocket attenuates their direct impact on binding interactions within the catalytic pocket.

Despite significant advancements in gene delivery and CRISPR technology, several challenges remain. Chief among these are overcoming serum inhibition and achieving high transfection efficiency with minimal cytotoxicity. To address these issues, there is a need for novel vectors that exhibit lower toxicity, maintain stability in serum-rich environments, and effectively deliver plasmids of various sizes across diverse cell types. In this study, to convert common polyethylenimine (PEI) into high-performance DNA delivery vectors, an innovative multifunctional vector was constructed based on histidine linked to PEI by redox-responsive disulfide bonds. Apart from highly efficient transfection of both small and large plasmids into HEK 293T (Human Embryonic Kidney 293T cells) with negligible cytotoxicity, PEI-S-S-His showed great transfection potential even at low plasmid doses (0.5 µg), as well as at serum concentrations ranging from 5 to 30% into HEK 293T cells, and achieved excellent plasmid transfection into NIH/3T3 (Mouse Embryonic Fibroblast cells), and MCF7 (Human Breast Cancer cells). Additionally, several metals were tested (Co, Cu, Cd, Ni, Zn, and Mn) to promote the plasmid packaging functionality and improve transfection efficiency. We observed that, in comparison to PEI-S-S-His, the manganese-functionalized nanocarrier (PEI-S-S-His-Mn) could transfect a large plasmid with equal efficiency (~ 30%) into MSCs (Mesenchymal Stem Cells). Interestingly, PEI-S-S-His-Mn showed higher transfection efficiency with the small plasmid (~ 90%) and the large one (~ 80%) into HEK 293T cells, even better than its backbone. We propose that the presence of metal-coordinated His ligand, redox-responsive S-S bonds, and the cationic polymer can synergistically provide robust DNA binding, efficient endosomal disruption, tolerance of serum protein adsorption, and low cytotoxicity. These new vectors could be promising for gene delivery and may be therapeutically relevant.

Azaleas (Rhododendron simsii) are popular ornamental woody plants known for their bright colors; however, very limited studies have been reported on the process of flower petal pigmentation. In this study, we found significant differences in the anthocyanin contents of petals from different colored azaleas, and the results of quantitative real-time PCR indicated that the R2R3 MYB genes, RsMYB12, RsMYB90, and RsMYB123, showed significant expression changes during the petal coloration in azalea petals; therefore, we hypothesized that RsMYB12, RsMYB90, and RsMYB123 might involve in the coloring process of azalea petals by regulating anthocyanin synthesis. This work provides insights into the underlying mechanisms of petal pigmentation in R. simsii and provides candidate genes for flower color breeding of azaleas and other ornamental flowers.

Recently biocementation has got attention of many researchers worldwide as one of the most potent techniques for sustainable construction. Several studies have been carried out worldwide on biocementation by urea hydrolysis. Biocementation by bacterially induced calcium carbonate precipitation by different bacterial species has been among the most widely researched areas in this field. Biocementation has proved efficient in enhancing the strength and durability of cement-based materials. However, no significant work has been carried out to determine the performance of biocemented specimens at elevated temperatures. This study primarily focuses on the effects of high temperatures (300, 450, and 600 °C) on the compressive strength of two types of biocemented specimens prepared by using ureolytic bacteria and rich in urease watermelon seeds. The motive behind testing these two types is to know how the enzyme induced or microbially induced react to temperature elevation. Also, the effect of different cooling techniques (viz., natural cooling, water spray cooling and fire extinguishing foam spray cooling) were studied. These cooling techniques were selected so as to check which cooling technique should be preferred in case of fire situation in a cement-based structure. Results show that biocemented specimens can perform very good up to the temperature 300 °C as compared to control specimens in terms of compressive strength. At 450 °C temperature, there is no significant difference in compressive strengths of control and biocemented specimens. When the specimens were subjected to 600 °C, biocemented specimens showed lower strength than control specimens at the same temperature due to denser microstructures. Thus, biocemented cement mortar should not be used in reactors, muffles and ovens where temperature would go above 450 °C.

Lasiodiplodia theobromae is an emerging threat and the main pathogenic fungi associated with basal stem rot of passion fruit in Guangxi Zhuang Autonomous Region, China. Current pathogen identification protocols are labor-intensive and time-consuming, emphasizing the need for more efficient methods to enable precise surveillance of L. theobromae for early detection and warning. The present study sought to develop a rapid colorimetric LAMP assay for early detection and surveillance of L. theobromae in passion fruit plants. For that, amplifications of ITS locus were performed on fungal genomic DNA using conventional PCR, with the specific primer pair ITS1 and ITS4. The hydroxy naphthol blue (HNB)-dependent colorimetric LAMP assay was then optimized by varying primer sets, inner primers concentration, reaction temperatures and incubation time. A microbial lysis buffer was employed to extract genomic DNA from stems infected with L. theobromae. The prime LAMP primer set targeting the ITS region of L. theobromae was designed and an HNB based colorimetric LAMP assay was optimized. Various optimization parameters were evaluated, with the optimal conditions determined as 1.6 μM of each FIB and BIP, 0.2 μM of each F3 and B3, and incubation at 65 °C for 40 min. This ITS-based LAMP assay could effectively distinguish L. theobromae from less dominant pathogens in passion fruits with a detection limit of 3 pg for ITS locus amplicons. Our proposed method utilizing a microbial lysis buffer enables rapid and cost-effective detection of L. theobromae DNA in early-infected passion fruit plants, eliminating the need for microbial cultivation and DNA purification.

Mitochondrial ribosomal protein L21 (MRPL21) is essential for normal cell function and may play a significant role in cancer development. In this study, we performed a comprehensive pan-cancer analysis to explore MRPL21's function across different cancers, utilizing multiple online data platforms such as TCGA. Our analysis covered its clinical significance and biological functions, including expression levels, survival and diagnostic analysis, gene mutations, multidimensional immune-correlation analysis, tumor heterogeneity, and cancer-associated signaling pathways. Additionally, we constructed a prognostic nomogram for lung adenocarcinoma (LUAD) patients based on MRPL21 and validated its biological function through in vitro experiments. Our findings revealed that MRPL21 is commonly overexpressed in various cancers and is associated with poor prognosis. It significantly impacts cancer-related pathways, particularly those related to cell cycle activation. Moreover, MRPL21 is critical in the tumor microenvironment and is closely linked to immune infiltration across several cancer types. Its expression correlates with essential factors such as tumor mutational burden, microsatellite instability, immune checkpoint, and methylation patterns. In LUAD, MRPL21 was identified as an independent risk factor and demonstrated that MRPL21 promotes LUAD progression. Overall, MRPL21 holds potential as both a diagnostic and prognostic marker in cancer and could serve as a promising therapeutic target, particularly for LUAD.

To deeply investigate the mechanism of ferroptosis-related genes in the process of bone nonunion based on the GEO database. And using Mendelian randomization to explore the causal association of 15 trace elements with the occurrence of bone nonunion. Bone nonunion RNA-seq data were retrieved and downloaded from the GEO database. The differentially expressed genes in bone nonunion were identified using two differential expression analysis methods, "limma" and "WGCNA". Random Forest Tree, Support Vector Machine, and Lasso-cox were used to analyze and screen the genes related to ferroptosis in bone nonunion; A risk model of bone nonunion was constructed based on the screened ferroptosis-related genes; based on this, the pathway mechanism of ferroptosis-related genes involved in the occurrence and development of bone nonunion was further investigated. Mendelian randomization analysis was performed using inverse variance weighting as the main analysis method, and weighted median, Weighted mode, Mr-Egger, and Simple mode were used as complementary methods. Heterogeneity was detected using Cochran's Q test and funnel plot analysis, horizontal pleiotropy was detected using Mr-Egger intercept, and sensitivity analyses were performed using the "leave-one-out" method. PTGS2/PRKCA/MAPK14 all showed excellent diagnostic efficacy for bone nonunion. The risk prediction model based on PTGS2, PRKCA, and MAPK14 showed good predictive efficacy and clinical benefit rate for bone nonunion. Ferroptosis core gene PRKCA may be involved in the VEGF signaling pathway to affect the cell cycle and inhibit fracture healing. MR analysis suggests that Potassium and Vitamin E are protective factors for the development of bone nonunion. Ferroptosis genes PTGS2/PRKCA/MAPK14 are potential diagnostic targets for bone nonunion. The down-regulation of PRKCA expression may inhibit fracture healing through the VEGF signaling pathway during the growth of blood vessels at fracture breaks. The results of MR suggested that Potassium and Vitamin E have a promoting effect on fracture healing.

Nucleolin (NCL) is a prevalent and widely distributed nucleolar protein in cells. While primarily located in the nucleolus, NCL is also found within the nucleoplasm, cytoplasm, and even on the cell surface. NCL's unique nature arises from its multifaceted roles and extensive interactions with various proteins. The structural stability of NCL is reliant on protease inhibitors, particularly in proliferating cells, indicating its essential role in cellular maintenance. This review is centered on elucidating the structure of NCL, its significance in host-viral interactions, and its various contributions to viral progeny production. This work is to enhance the scientific community's understanding of NCL functionality and its implications for viral infection processes. NCL is highlighted as a crucial host protein that viruses frequently target, exploiting it to support their own life cycles and establish infections. Understanding these interactions is key to identifying NCL's role in viral pathogenesis and its potential as a therapeutic target. Our current knowledge, alongside extensive scientific literature, underscores the critical role of host proteins like NCL in both viral infections and other diseases. As a target for viral exploitation, NCL supports viral replication and survival, making it a promising candidate for therapeutic intervention. By delving deeper into the intricacies of NCL-viral protein interactions, researchers may uncover effective antiviral mechanisms. This review aspires to inspire further research into NCL's role in viral infections and promote advancements in antiviral therapeutic development.

Opioids are the primary regimens for perioperative analgesia with controversial effects on oncological survival. The underlying mechanism remains unexplored. This study developed survival-related gene co-expression networks based on RNA-seq and clinical characteristics from TCGA cohort. Two survival-related networks were identified, and drug-induced transcriptional profiles were predicted. Immune cell infiltration algorithm, least absolute shrinkage and selection operator (LASSO) regression, and cox proportional models were executed to explore the correlation between opioid-related drugs and prostate cancer patient prognosis. The opioid receptor agonists, represented by tramadol, were evidenced for anti-survival effects on prostate cancer by facilitating the DNA replication and cell cycle, and immune cell infiltration. Conversely, opioid receptor antagonists showed pro-survival effects. A novel prognostic model containing CNIH2, MCCC1, and Gleason scores was established and validated in two independent cohorts. This study revealed opioids' effect on prostate cancer progression, and provided a novel model to predict these regulations in clinical outcomes.

Perinatal white matter injury (WMI), which is prevalent in premature infants, involves M2 microglia affecting oligodendrocyte precursor cells (OPCs) through exosomes, promoting OPC growth and reducing WMI. The molecular mechanism of WMI remains unclear, and this study explored the role of M2 microglia-derived exosomes in WMI. A tMCAO rat model was constructed to simulate WMI characteristics in vivo. Cresyl violet staining, neurobehavioral tests, rotarod tests, immunofluorescence and immunochemistry were used to assess the role of exos-derived miR-144-5p in pathological and neurological changes in rats. OGD/R cellular models were constructed to mimic WMI characteristics in vitro. CCK-8, TUNEL, Western blotting and immunofluorescence were used to assess the role of exos-derived miR-144-5p in OPC phenotypes. Rescue assays were used to assess the role of the PTEN/AKT pathway in miR-144-5p-mediated OPC phenotypes. Bioinformatics and mechanistic experiments were used to assess the association of PTEN or KLF12 with miR-144-5p in OPCs. M2-Exos suppressed cerebral injury and facilitated demyelination repair in rats post WMI. M2-Exos suppressed OGD/R-stimulated OPC apoptosis and facilitated OGD/R-stimulated OPC differentiation. M2-Exo-derived miR-144-5p suppressed OGD/R-stimulated OPC apoptosis and facilitated OGD/R-stimulated OPC differentiation. M2-Exo-derived miR-144-5p suppressed cerebral injury and facilitated demyelination repair in rats post WMI. MiR-144-5p suppressed OGD/R-stimulated OPC apoptosis and facilitated OGD/R-stimulated OPC differentiation through PTEN downregulation. MiR-144-5p targeted the KLF12 3'UTR to repress PTEN transcription in OPCs. M2 microglia secrete miR-144-5p to reduce WMI by targeting KLF12 in OPCs, inhibiting PTEN/AKT pathway activity, and offering potential targeted therapeutic insights for WMI.

Quantitative polymerase chain reaction (qPCR) is a vital molecular technique for biomarker detection; however, its clinical application is impeded by the scarcity of robust biomarkers and the inherent limitations of the technology. This study conducted a bibliometric analysis of 4063 qPCR-based biomarker studies sourced from the Web of Science (WOS) database, employing VOSviewer and CiteSpace to generate multi-dimensional structural insights into this field. The results reveal a growing trend in research within this domain, with gene expression analysis playing a central role in the identification of potential biomarkers. Among these, cancer-related biomarkers are the most prominent, while research on biomarkers for other diseases remains limited. Liquid biopsy biomarkers, including microRNA (miRNA), circulating free DNA (cfDNA), and circulating tumor DNA (ctDNA), are increasingly being explored. The integration of bioinformatics, omics analysis, and high-throughput technologies with qPCR is accelerating biomarker discovery. Furthermore, large-scale parallel sequencing is emerging as a potential alternative to relative quantification and microarray techniques. Nevertheless, qPCR remains essential for validating specific biomarkers, and further standardization of its protocols is necessary to enhance reliability. This study provides a systematic analysis of qPCR-based biomarker research and underscores the need for future technological integration and standardization to facilitate broader clinical applications.

Nine homologous Cold Shock Proteins (Csps) have been recognized in the E.coli Cold Shock Domain gene family. These Csps function as RNA chaperones. This study aims to establish the evolutionary relationships among these genes by identifying and classifying their paralogous counterparts. It focuses on the physicochemical, structural, and functional analysis of the genes to explore the phylogeny of the Csp gene family. Computational tools were employed for protein molecular modeling, conformational analysis, functional studies, and duplication-divergence assessments. The research also examined amino acid conservation, protein mutations, domain-motif patterns, and evolutionary residue communities to better understand residual interactions, evolutionary coupling, and co-evolution. H33, M5, W11 and F53 residues were highly conserved within the protein family. It was further seen that residues M5, G17, G58, G61, P62, A64, V67 were intolerant to any kind of mutation whereas G3, D40, G41, Y42, S44, T54, T68, S69 were most tolerable towards substitutions. The study of residue communities displayed that the strongest residue coupling was observed in N13, F18, S27, F31, and W11. It was observed that all the gene pairs except CspF/CspH had new motifs generated over time. It was ascertained that all the gene pairs underwent asymmetric expression divergence after duplication. The K/ K ratio also revealed that all residues undertook neutral and purifying selection pressure. New functions were seen to develop in gene pairs evident from generation of new motifs. The discovery of new motifs and functions in Csps highlights their adaptive versatility, crucial for E. coli's resilience to environmental stressors and valuable for understanding bacterial stress response mechanisms. These findings will pave the way for future investigations into Csp evolution, with potential applications in microbial ecology and antimicrobial strategy development.

Renal ischemia-reperfusion injury (RIRI) is a primary cause of acute kidney injury (AKI), frequently resulting in high mortality rates and progression to chronic kidney disease (CKD). This study aimed to investigate the therapeutic potential of total saponins from Panax notoginseng (PNS) in the context of RIRI. Utilizing a murine RIRI model, the efficacy of PNS was evaluated, demonstrating a significant reduction in renal inflammation and cellular pyroptosis. Furthermore, PNS was found to modulate the ROCK2/NF-κB signaling pathway, thereby attenuating the inflammatory response. Importantly, in vitro experiments with hypoxia/reoxygenation cell models corroborated these findings, showing that PNS inhibited pyroptosis and regulated the ROCK2/NF-κB pathway. This research underscores the therapeutic potential of PNS in the treatment of RIRI, providing a robust scientific basis for its consideration as a prospective clinical therapy.

Antibodies have specific binding capabilities and therapeutic potential for treating various diseases, including viral infections. The amino acid composition of the hypervariable complementarity determining regions (CDR) loops and the framework regions (FR) are the determining factors for the affinity and therapeutic efficacy of the antibodies. In this study selected and curated, 77 viral antigen-human antibody complexes from Protein data bank from the Thera-SAbdab database were analyzed. The results revealed diversity indices within specific CDR regions, amino acid frequencies, paratope-epitope interactions, bond formations, and bond types among the analyzed viral Ag-Ab complexes. The finding revealed that Ser, Gly, Tyr, Thr, and Phe are prominently present in the antibody CDRs. Analysis of CDR profiles indicated an average amino acid diversity of 60-80% in heavy chain CDRs and 45-60% in light chain CDRs. Aromatic residues, particularly Tyr, Phe, and Trp showed significant involvement in the paratope-epitope interactions in the heavy chain, while Tyr, Ser, and Thr were key contributors in the light chain. Furthermore, the study examined the occurrence of amino acids in both light and heavy chains of viral Ag- human Ab complexes, analyzing the presence of amino acids as single residues, dipeptides and tripeptides. The analysis is crucial for enhancing the antibody engineering processes including, design, optimization, affinity enhancement, and overall antibody development.

Oncolytic viral-based therapy and specific gene expression by promoters are modern targeted oncotherapy approaches that have gained significant attention in recent years. In this study, both strategies were combined by designing cancer-specific activation of vesicular stomatitis virus matrix expression under the survivin promoter. The matrix sequence was cloned downstream of the survivin promoter (pM). After transfecting MCF-7 cells with pM, cell proliferation and apoptosis induction were assessed. Additionally, the transcript levels of matrix and apoptosis-related genes in response to pM was assessed. The proliferation of MCF-7 cells was significantly reduced by the constructed matrix-expressing plasmid at 48 and 72 h post-transfection (p < 0.05). Enhanced matrix expression resulted in the down-regulation of MMP-9, TP53, and NF-kB, while simultaneously up-regulating Bax transcripts. Evaluating the effect of pM vector on apoptosis induction revealed a significant increase in the MCF-7 cells compared to untreated cells (p < 0.05). The absence of significant matrix gene expression in HDF cells, relative to MCF-7 cells, further underscores the specific function of the Survivin promoter in cancer cells. These findings suggest that the matrix may have various biological functions in a diverse set of non-apoptotic pathways. Further research on the association of the matrix with other genes could provide insights into the biomedical significance and future perspectives of the matrix in cancer gene therapy.

Androgen deprivation therapy (ADT) is the primary treatment strategy for prostate cancer. However, despite an initially favorable response, tumors inevitably progress to castration-resistant prostate cancer (CRPC). Therefore, the exploration of new therapeutic approaches targeting CRPC has become imperative. Increasing evidence suggests that hypoxia plays a crucial role in the development of CRPC. In this study, we found that the emergence of alkaliptosis resistance and the expression of its marker, CA9, significantly contribute to the progression of castration resistance induced by hypoxia. This study utilized bioinformatics approaches to identify genetic determinants associated with alkaliptosis resistance and explored the clinical significance of these marker genes. Transcriptomic sequencing was performed on the DU145 prostate cancer cell line, which had been induced to acquire alkaliptosis resistance. Using least absolute shrinkage and selection operator (LASSO) regression analysis, a prognostic risk model consisting of 12 genes, including ADORA2A, KCNG4, SEC14L5, B3GAT2, SLFNL1, FAM72D, CBWD3, PPM1K, STARD4, DEPDC1B, MATN3, and DDIAS was developed. The risk model score demonstrated a strong correlation with key patient clinical characteristics, including Gleason score, PSA levels, T stage, and N stage, and was also associated with immune therapy response and biochemical recurrence-free survival (BCRFS). Furthermore, ADORA2A expression in cellular models was found to be a critical factor in promoting alkaliptosis resistance.

One kind of hydroxycinnamic acid is calceolarioside A. Plantago coronopus, Cassinopsis madagascariensis, and other organisms for whom data are available are known to have this naturally occurring compound. IC50 values of Calceolarioside A for ovarian cell lines (NIH-OVCAR-3, ES-2, UACC-1598, Hs832.Tc, TOV-21G, UWB1.289) were 24.42, 13.50, 9.31, 14.90, 20.07, and 16.18 µM, respectively. IC50 values were 19.83 and 73.48 µM for tyrosinase and HMG-CoA reductase enzymes. The chemical activities of Calceolarioside A against HMG-CoA reductase and tyrosinase were assessed by conducting the molecular docking study, MM/GBSA calculation, and molecular dynamics (MD) simulation. The anticancer activities of this compound were evaluated against some ovarian cancer cells, such as NIH-OVCAR-3, ES-2, UACC-1598, Hs832.Tc, TOV-21G, and UWB1.289 cell lines. The chemical activities of Calceolarioside A against some of the expressed surface receptor proteins (folate receptor, CD44, EGFR, Formyl Peptide Receptor-Like 1, M2 muscarinic receptor, and estrogen receptors) were investigated using computational methods. The results exhibited the interplay among atoms. The compound formed robust associations with both the enzymes and receptors. Calceolarioside A can hinder the functioning of these enzymes and the proliferation of malignant cells.

The field of gene therapy has witnessed significant advancements in the utilization of Adeno-associated virus (AAV) owing to its inherent biological advantages. Targeted AAV vectors are generated through genetic or chemical modification of the capsid for user-directed purposes. However, this process can result in imbalances in viral protein sequence homogeneity, stoichiometry, and functional transduction vector units, thereby introducing new challenges. This mini review focuses on the ongoing efforts to develop targeted vectors, which inadvertently present unsolicited obstacles for clinical application and provided perspectives on future directions.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target. A molecular beacon of 33 nucleotides was designed with the sequence 5'[Fluorescein] ATAGTCCTTCAACAATCTTATCCCTAGCACTAT[Dabcyl]3', incorporating stem and loop regions. Secondary and tertiary structure characterizations confirmed the desired stem-loop structure without internal secondary structures. The thermal stability of the molecular beacon-target complex was studied using a temperature vs. Gibbs free energy change plot, melting curve analysis based on absorbance vs. temperature, and an experimental fluorescence resonance energy transfer melting assay. The melting temperature of the molecular beacon-target complex was experimentally determined to be 62 °C. The spectral analysis showed fluorescence restoration in the presence of the synthetic VP6 target. The assay conditions were optimized with an excitation wavelength of 470 nm and a 10-min incubation time. The assay demonstrated a linear correlation between fluorescence intensity restoration and target concentration, with a limit of detection of 18.8 nM. Interference studies with single mismatch, double mismatch, and scrambled targets revealed that the molecular beacon has strong specificity for the VP6 target, effectively discriminating against non-target sequences. This work demonstrates the molecular beacon's potential as a sensitive and specific tool for detecting rotavirus A VP6 gene, with promising applications in diagnostic assays for the rotavirus disease management.